Data Access

1) View all of the mutation details in the database
2) View all of the patient details with complete data in the database
3) View all of the population frequency of variants from ALSoD mapped to the 1000 genomes
4) View all of the population frequency of variants from ALSoD mapped to the EVS genomes
5) View all of the genes on the database

All of the mutations in ALSoD. (661)

Click   to download all of the mutation data from ALSoD. **** If  you use these data, cite us Abstract

Mutant StructureMutation nameMutation codeGeneTypeSeq. OriginalSeq. MutatedAA. OriginalAA. MutatedCodon NumberExon/IntronExon/Intron NumberHGVS_NucleotideHGVS_proteinLocation(Chr)dbSNP
SelectAla46delA261delAALS2DeletionGCAAAla 46exon3    
SelectAla46delAA47fsX4ALS2DeletionGCA at position +3 Ala 47exon3    
SelectSer100IleS100IALS2SubstitutionGTSerIle100exon4NM_020919.3:c.299 G >TNP_065970.2:p.S100I  
SelectThr185delAT185fsX5ALS2DeletionACT at position +1 Thr 185exon4    
Select2660delATN846fsX13ALS2DeletionGCAATAla 377exon5    
SelectAla377delAT1130delATALS2DeletionGCAATAla 377exon5    
SelectGlu476delAG1548delAGALS2DeletionGAG at position +2 Glu 476exon5    
SelectGln490delGTTTCCCCCANT1471ALS2DeletionCAAGTTTCCCCCAGln 490exon5    
SelectLeu623delCTL623fsX24ALS2DeletionCTG at position +1 Leu 623exon9    
SelectGly668STOPG668XALS2SubstitutionGTGlySTOP668exon NM_020919.3:c.G2002TNP_065970.2:p.G668X  
Selectc.2580-2 A>Gc.2580-2 A>GALS2SubstitutionAG  890exon14NM_020919.3:c.2580-2 A>G   
SelectGly1172GlufsX29G1172EfsX29ALS2DeletionG GlyGlu1172exon     
SelectVal1189TrpfsX19V1189WfsX19ALS2DeletionG ValTrp1189exon     
SelectTyr1248delAM1207XALS2DeletionTATATyr 1248exon24    
SelectVal1525fsV1525fsALS2Frameshift    1525exon NM_020919.3:c.4573dupGNP_065970.2:p.V1525fs  
SelectIle1614delTV1574fsX44ALS2DeletionATTTIle 1614exon33    
SelectGly-10AspG-10DANGSubstitution  GlyAsp-10exon2 NP_001136.1:p.Q(-10)D  
SelectLys17GluK17EANGSubstitutioncAAAGAALysGlu17exon2NM_001145.4:c.250A>G NP_001136.1:p.Lys84Glu14:21161973rs17560
SelectIle46ValI46VANGSubstitutiontATTGTTIleVal46exon2NM_001145.4:c.208A>G NP_001136.1:p.I70V14:21161931rs121909541
SelectThr80SerT80SANGSubstitutionCGThrSer80exon2NM_001145.4:c.311C>G NP_001136.1:p.T104S14:21162034 
SelectPhe100IleF100IANGSubstitution  PheIle100exon2NM_001145.4:c.298T>ANP_001136.1:p.Phe100Ile 14:21162021
Selectintron 6, + 1 delG (GT> TT)intron 6, + 1 delG (GT> TT)ARHGEF28splicing     intron6    
SelectK280M> fs40XK280M> fs40XARHGEF28frameshift    280exon     
SelectCAG repeat size 33CAG repeat size 33ATXN2RepeatExp00  0exon     
SelectCAG repeat size 34CAG repeat size 34ATXN2RepeatExp00  0exon     
SelectCAG repeat size 36CAG repeat size 36ATXN2RepeatExp00  0exon     
SelectCAG repeat size 39CAG repeat size 39ATXN2RepeatExp00  0exon     
SelectCAG repeat size 37CAG repeat size 37ATXN2RepeatExp00  0exon     
SelectCAG repeat size 35CAG repeat size 35ATXN2RepeatExp00  0exon     
SelectCAG repeat size 31CAG repeat size 31ATXN2RepeatExp00  0exon     
SelectCAG repeat size 27CAG repeat size 27ATXN2RepeatExp00  0exon     
SelectCAG repeat size 32CAG repeat size 32ATXN2RepeatExp00  0exon     
SelectGlu32ValE32VBCL11BSubstitutionATGluVal32exon NM_022898.1:c.95A>TNP_075049.1:p.E32V14:99724140 
SelectAsn73SerN73SBCL6SubstitutionAGAsnSer73exon NM_001706.4:c.218A>GNP_001697.2:p.N73S3:187449662 
SelectHREMHREMC9orf72Repeat GGGGCC  0intron1    
SelectArg65CysR65CCDH13SubstitutionCTArgCys65exon NM_001257.4:c.193C>TNP_001248.1:p.R65C16:83065650 
SelectAla103ValA103VCDH13SubstitutionCTAlaVal103exon NM_001257.4:c.308C>TNP_001248.1:p.A103V16:83065765 
SelectGly113ArgG113RCDH13SubstitutionGCGlyArg113exon NM_001257.4:c.337G>CNP_001248.1:p.G113R16:83065794rs183971768
SelectArg246TrpR246WCDH13SubstitutionCTArgTrp246exon NM_001257.4:c.736C>TNP_001248.1:p.R246W16:83378566 
SelectGlu367GlnE367QCDH13SubstitutionGCGluGln367exon NM_001257.4:c.1099G>CNP_001248.1:p.E367Q16:83636197rs200000145
SelectGlu92LysE92KCDH22SubstitutionGAGluLys92exon NM_021248.2:c.274G>ANP_067071.1:p.E92K  
SelectThr134MetT134MCDH22SubstitutionCTThrMet134exon NM_021248.2:c.401C>TNP_067071.1:p.T134M  
SelectArg533HisR533HCDH22SubstitutionGAArgHis533exon NM_021248.2:c.1598G>ANP_067071.1:p.R533H  
SelectPro80LeuP80LCHCHD10Substitution  ProLeu80exon     
SelectSer103CysS103CCHMP2BSubstitutionCGSerCys103exon   3:87295045 
SelectGlu201GlnE201QCHMP2BSubstitutionGAGluGln201exon   3:87302931 
SelectPhe314ValF314VCNTN6SubstitutionTGPheVal314exon NM_014461.2:c.940T>GNP_055276.1:p.F314V3:1363512rs144474590
SelectGlu954ValE954VCNTN6SubstitutionATGluVal954exon NM_014461.2:c.2861A>TNP_055276.1:p.E954V3:1444045 
SelectAsn406SerN406SCRIM1SubstitutionAGAsnSer406exon NM_016441.2:c.1217A>GNP_057525.1:p.N406S2:36706682rs139895660
SelectArg169CysR169CCRYMSubstitutionCTArgCys169exon NM_001888.3:c.505C>TNP_001879.1:p.R169C16:21279043rs148349291
SelectVal249IleV249ICX3CR1Substitution00ValIle249exon    rs3732379
SelectThr280MetT280MCX3CR1Substitution00ThrMet280exon    rs3732378
SelectArg199TrpR199WDAOSubstitutionCTArgTrp199exon NM_001917.4:c.595C>TNP_001908.3:p.R199W12:109288126rs3825251
SelectGly59ArgG59RDCTN1Substitution  GlyArg59exon     
SelectIle234ThrI234TDIAPH3SubstitutionTCIleThr234exon NM_001042517.1:c.701T>CNP_001035982.1:p.I234T13:60554984 
SelectPro578LeuP578LDIAPH3SubstitutionCTProLeu578exon NM_001042517.1:c.1733C>TNP_001035982.1:p.P578L13:60545212rs76366906
SelectPro588LeuP588LDIAPH3SubstitutionCTProLeu588exon NM_001042517.1:c.1763C>TNP_001035982.1:p.P588L13:60545182rs111260336
SelectPro596LeuP596LDIAPH3SubstitutionCTProLeu596exon NM_001042517.1:c.1787C>TNP_001035982.1:p.P596L13:60545158rs150023947
SelectArg1042HisR1042HDIAPH3SubstitutionGAArgHis1042exon NM_001042517.1:c.3125G>ANP_001035982.1:p.R1042H13:60384960rs200189161
SelectArg1191XR1191XDIAPH3SubstitutionCTArgX1191exon NM_001042517.1:c.3571C>TNP_001035982.1:p.R1191X13:60240729 
SelectArg209LeuR209LDOC2BSubstitutionGTArgLeu209exon NM_003585.3:c.626G>TNP_003576.2:p.R209L17:11884 
SelectArg927GlnR927QERBB4SubstitutionGAArgGln927exon NM_005235.2:c.2780G>ANP_005226.1:p.Arg927Gln2:212288966ss831884245
SelectArg1275TrpR1275WERBB4SubstitutionCTArgTrp1275exon NM_005235.2:c.3823C>TNP_005226.1:p.Arg1275Trp2:212248444ss831884246
SelectCAG repeat size 25CAG repeat size 25ErrorRepeatExp00  0exon     
SelectGly188AspG188DFEZF2SubstitutionGAGlyAsp188exon NM_018008.3:c.563G>ANP_060478.3:p.G188D3:62357981rs199850439
SelectArg183STOPR183XFIG4SubstitutionCTArg 183exon6    
SelectGln403STOPQ403XFIG4SubstitutionCTGln 403exon11    
SelectSer424_K462S424del insRFIG4SubstitutionGTSerSTOP424exon12    
SelectGly51GlyG51GFUSSubstitutionCTGlyGly51exon3NM_004960.3:c.153 C>TNP_004951.1:p.G51G16:31193948rs61733962
SelectSer57delTCTS57delTCTFUSDeletionTCT Ser 57exon3NM_004960.3:c.169_171delTCTNP_004951.1:p.S57del16:31101465 
SelectSer96delCCTACinsAT287291delCCTACinsATFUSDeletion    96exon4NM_004960.3:c.287291delCCTACinsATNP_004951.1:p.Ser96del16:31488469 
Selectc.491_495 +1delGAGGTgcG144_Y149delFUSDeletion delGGACAGGly 144exon5NM_004960.3:c.491_495 + 1delGAGGTgcNP_004951.1:p.G174_G175del  
SelectAsn159TyrN159YFUSSubstitutionAACTACAsnTyr159exon5NM_004960.3:c.475 A>TNP_004951.1:p.N159Y16:31195669 
Selectc.521_523+3delGAGGTGG173_G174delFUSDeletionGAGGTG GAGGTG 173exon5NM_004960.3:c.521_523+3delGAGGTGNP_004951.1:p.G173_G174del16:31195715 
Selectc.430_447delGGACAGCAGCAAAGCTATG174_G175delFUSDeletion delGAGGly 174exon5NM_004960.3:c.430_447delGGACAGCAGCAAAGCTATNP_004951.1:p.G144_Y149del16:31195624 - 16:31195641 
SelectGly175G175FUSInsertionGGTGAGGTGGly 175exon6    
Selectc.666_667insGGCG222_G223insGFUSInsertion insGGCGly 222exon6NM_004960.3:c.666_667insGGCNP_004951.1:p.G222_G223insG rs72550890
Selectc.667_669delGGCG223delFUSDeletion delGGCGly 223exon6NM_004960.3:c.667_669delGGCNP_004951.1:p.G223del rs72550890
SelectG223-G226delc.667-678delGGCGGCGGCGGCFUSDeletion    223exon6NM_004960.3:c.667-678delGGCGGCGGCGGCNP_004951.1:p.G223-G226del  
Selectc.676_684del228_230delGGGFUSDeletionGGG GGG 228exon6NM_004960.3:c.676_684delNP_004951.1:p.228_230delGGG  
Selectc.684_685insGGCGly228_Gly229insGlyFUSInsertion GGC GGC228exon6NM_004960.3:c.684_685insGGCNP_004951.1:p.Gly228_Gly229insGly  
Selectc.681_684delGGC230delGFUSDeletionG G 230exon6NM_004960.3:c.681_684delGGCNP_004951.1:p.230delG  
SelectY485AfsX514c.1449-1488delCTACCGGGGCCGCGGCGGGGACCGTGGAGGCTTCCGAGGGFUSframeshift    485exon14NM_004960.3:c.1449-1488delCTACCGGGGCCGCGGCGGGGACCGTGGAGGCTTCCGAGGGNP_004951.1:p.Y485AfsX514  
SelectR495EfsX527c.1483delCFUSframeshift    485exon14NM_004960.3:c.1483delCNP_004951.1:p.Arg495Glufs16:31202373 
SelectG497AfsX527c.1485delAFUSframeshift    485exon14NM_004960.3:c.1485delANP_004951.1:p.Arg495Arg=fs16:31202375 
SelectK510WfsX517c.1527insTGGCFUSframeshift    485exon14NM_004960.3:c.1527insTGGCNP_004951.1:p.K510WfsX517  
SelectR495QfsX527c.1484delGFUSframeshift    495exon14NM_004960.3:c.1484delGNP_004951.1:p.Arg495Glnfs16:31202374 
SelectGly496Glyfs*31c.1486delGFUSDeletionG Gly 496exon     
Selectc.1507_1508delAGG503WfsX12FUSDeletionAG AG 503exon14NM_004960.3:c.1507_1508delAGNP_004951.1:p.G503WfsX1216:31202397 
SelectLys510GluK510EFUSSubstitutionAAGGAGLysGlu510exon13 NP_004951.1:p.K510E  
Selectc.1506dupAR502fsX15FUSSubstitution  Arg 520exon14NM_004960.3:c.1506dupANP_004951.1:p.R502fsX15  
Selectc.1581delAX527YextXFUSDeletionA A 527exon15NM_004960.3:c.1581delANP_004951.1:p.X527YextX16:31202759 
Selectc.1965-2A>Cc.1965-2A>CGLE1Splice-siteAC   intron     
SelectHis507TyrH507YGRB14SubstitutionCTHisTyr507exon NM_004490.2:c.1519C>TNP_004481.2:p.H507Y2:165349650rs144301087
SelectAsp314AsnD314NHNRNPA1Substitution  AspAsn314exon NM_031157.2:c.940G>ANP_112420.1:p.D314N12:54677628rs397518453
SelectAsn319SerN319SHNRNPA1Substitution  AsnSer319exon NM_031157.2:c.956A>GNP_112420.1:p.Asn319Ser12:54283860 
SelectAla436ValA436VLMNB1SubstitutionCTAlaVal436exon NM_005573.3:c.436C>T 5:126156748 
SelectLeu199ProL199PLUMSubstitutionTCLeuPro199exon NM_002345.3:c.596T>CNP_002336.1:p.L199P12:91502161rs147975710
SelectSer85CysS85CMATR3SubstitutionCGSerCys85exon NM_199189.2:c.85C>G 5:138643358 
SelectPhe115Cys F115CMATR3SubstitutionTGPheCys115exon NM_199189.2:c.115T>G 5:138643448 
SelectPro154SerP154SMATR3SubstitutionCTProSer154exon NM_199189.2:c.154C>T 5:138643564 
SelectThr622AlaT622AMATR3SubstitutionAGThrAla622exon NM_199189.2:c.622A>G 5:138658372 
Select2368-2370del2368-2370delNEFHDeletion     exon     
SelectAla40ValA152VNEFHSubstitutionCTAlaVal40exon NM_021076.3:c.119C>TNP_066554.2:p.A40V22:29876370 
SelectArg346HisR346HNEFHSubstitutionGAArgHis346exon NM_021076.3:c.1037G>ANP_066554.2:p.R346H22:29879517 
Select1582-1683delA528delGCT..stop 987NEFHDeletiongct at position +1 Ala 528exon4    
Select1965-1988delP655delAGA..stop at 662NEFHDeletioncca at position +3 Pro 655exon4    
Select1989-2006delP663delTGAGAAGGCCAAGTCCCCNEFHDeletioncct at position +3 Pro 663exon4    
Select1989-2030delP663delTGA..stop at 1007NEFHDeletioncct at position +3 Pro 663exon4    
Select2080-2163insAla708ins84bpNEFHInsertiongcc Ala 708exon4    
Select2230-2247delA744delGCC..stop at 1015NEFHDeletiongcc at position +1 Ala 744exon4    
SelectLys867AsnK867NNEFHSubstitutionGTLysAsn867exon NM_021076.3:c.2601G>TNP_066554.2:p.K867N22:29886230rs138156220
SelectGlu918GlyE918GNEFHSubstitutionAGGluGly918exon NM_021076.3:c.2753A>GNP_066554.2:p.E918G22:29886382rs189881592
SelectGly401ArgG401RNETO1SubstitutionGAGlyArg401exon NM_138966.3:c.1204G>ANP_620416.1:p.G401R18:70417634rs149193005 
SelectAla86GlyA86GNIPA1Substitution  AlaGly86exon     
SelectIle120MetI120MNIPA1Substitution  IleMet120exon     
SelectVal162MetV162MNIPA1Substitution  ValMet162exon     
SelectMet189IleM189INIPA1Substitution  MetIle189exon     
SelectArg281GlnR281QNIPA1Substitution  ArgGln281exon     
SelectHis69TyrH69YOMA1SubstitutionCTHisTyr69exon NM_145243.3:c.205C>TNP_660286.1:p.H69Y1:59004762rs75220198
SelectGlu272GlyE272GOMA1SubstitutionAGGluGly272exon NM_145243.3:c.815A>GNP_660286.1:p.E272G1:58999918rs139938730
SelectAsp365TyrD365YOMA1SubstitutionGTAspTyr365exon NM_145243.3:c.1093G>TNP_660286.1:p.D365Y1:58996320rs77980955
SelectM98K/G291fsM98K/G291fsOPTNFrameshift     exon     
Selectc.553-5C>Tc.553-5C>TOPTNSplice-site     exon NM_021980.4:c.553-5C>T 10:13158262rs2244380
SelectdelExon5delExon5OPTNSubstitution   0exon5    
SelectLeu100LeuL100LOPTNSilent  LeuLeu100exon5    
SelectAla134AlaA134AOPTNSilent  AlaAla134exon6   rs113955718
SelectLeu164LeuL164LOPTNSilent  LeuLeu164exon6    
SelectGln165STOPQ165XOPTNSubstitutionCTGln 165exon6NM_021980.4:c.493C>TNP_068815.2:Q165X10:13154576 
SelectPro286ProP286POPTNSubstitutionGAProPro286exon NM_021980.4:c.876G>ANP_068815.2:p.Pro292=10:13164481rs151065414
SelectLys316GluK316EOPTNSubstitutionGALysGlu316exon NM_021980.4:c.964G>ANP_068815.2:p.Glu322Lys10:13166076rs523747
Selectdel P359del P359OPTNDeletion    359exon     
Select1242+1G>A_insA1242+1G>A_insAOPTNInsertion    414exon12    
SelectLys440Asnfs*8K440Nfs*8OPTNSubstitution  LysAsn440exon     
Selectc.1401+4A/Gc.1401+4A/GOPTNSubstitutionAGAG467exon13NM_021980.4:c.1401+4A>G 10:13169907 
Selectc.552+1delGc.552+1delGOPTNSubstitutionG LysThr557exon